addgene/openbio/docs

The Recombination Command

The recombination command helps Addgene’s Research team detect recombination events in viral vectors by analyzing Next Generation Sequencing (NGS) results of the packaged viral genome. The team primarily uses this command to quantify Lox site recombination in FLEX/DIO constructs. In other words, this command can be used to determine the proportion of viral particles that contain recombined Lox sites and thus could direct Cre-independent transgene expression. This is important because a high percentage of recombined lox sites in a viral vector preparation could lead to background transgene expression in experiments.

The recombination command helps Addgene’s Research team detect recombination events in viral vectors by analyzing Next Generation Sequencing (NGS) results of the packaged viral genome. The team primarily uses this command to quantify Lox site recombination in FLEX/DIO constructs. In other words, this command can be used to determine the proportion of viral particles that contain recombined Lox sites and thus could direct cre-independent transgene expression. This is important because a high percentage of recombined lox sites in a viral vector preparation could lead to background transgene expression in experiments.

The command’s parameters can be modified by editing the file parameters.yml in your favorite text editor. To change the parameter values, locate the section named recombination and follow the examples in the file. The parameters are:

• input_folder: the folder where the FASTQ files are (follow the examples in the file).
• output_folder: the folder for the output CSV files (follow the examples in the file).
• HEAD: the number of bases before the seed sequence
• TAIL: the number of bases after the seed sequence
• seed_sequences: the name and sequence of the seeds to look for. Add as many as you want, following the example syntax and separated by commas.

You may vary the seed sequences to search for sequences other than Lox sites if you would like to check for recombination at other sites. We use the following seed sequences for our DIO/FLEX vectors, which typically have both LoxP and Lox2272 sites:

Site	Sequence
LoxP	ATAACTTCGTATAGCATACATTATACGAAGTTAT
Lox2272	ATAACTTCGTATAGGATACTTTATACGAAGTTAT

Procedure

1. Adjust the parameters for the script by editing the file parameters.yaml as described above.
2. In a terminal window, navigate to the toolkit folder (if you’re using our Docker container, run the container first):

    cd openbio-master/toolkit
   

3. Issue the following command:

    python atk.py recombination
   

4. When the command finishes, you will find the output CSV files in the folder you selected. The file names reflect the parameters used. For example, the output file:

   A11984_sW0158_H09_R_001-60-lox2272-60.csv

   Is the output corresponding to:

   • FASTQ file: A11984_sW0158_H09_R_001.fastq
   • HEAD = 60, Seed sequence = lox2272, TAIL = 60